Processos Celulares e Moleculares no Desenvolvimento do Sistema Visual em Operárias e Zangões de... por David Santos Marco Antonio - Versão HTML

ATENÇÃO: Esta é apenas uma visualização em HTML e alguns elementos como links e números de página podem estar incorretos.
Faça o download do livro em PDF, ePub, Kindle para obter uma versão completa.

1031

L2-L3

0,0000000

1º Qu.

243 354 598,5

1028

L2-L4

0,0000000

Min

242 332 572 971 L3-L4

0,0000000

Como critério de seleção para a fase de tecelagem de casulo (Spinning S) observou-se

o gradual esvaziamento do conteúdo intestinal em larvas em células recentemente

operculadas. Para a pré-pupa observou-se a segmentação da cabeça e tórax, o alargamento dos

olhos, o progresso da apólise, a visualização do intestino e a reabsorção do líquido exuvial

(Tabela 2). Após o reconhecimento da fase, as larvas foram imediatamente dissecadas e

fixadas ou homogeneizadas em TRIzol (Invitrogen).

Tabela 2. Fases do desenvolvimento larval de operárias e zangões de Apis mellifera (Michelette & Soares, 1993) Fase Sigla

Características

(Operária)

3º instar

L3

1,5 – 4,45 mg

4º instar

L4

4,8 – 24,8 mg

F1

27 – 41 mg / 40 – 129 mg (Zangão)

F (alimentação) – célula F2

54 – 90 mg / 130 – 269 mg (Zangão)

aberta

F3

107 – 115 mg / 270 – 400 mg (Zangão)

S1

Intestino cheio

S (spinning) – tecela-

S2

Intestino metade vazio

Movimento

5º instar gem do casulo

S3

Intestino completamente vazio

L5

Medida Tíbio-Tarsal

PP1

1,2 – 1,44 mm / 1,4 - ,199 (Zangão)

Pré-Pupa

PP2

1,8 – 2,0 mm / 2,0 – 2,6 (Zangão)

PP3

cutícula opaca / > 2,6 (Zangão)

Material e Métodos | 22

Análise histológica

Após a classificação da fase do desenvolvimento, as larvas e pupas tiveram a cabeça

removida em salina Ringer, e esta foi rapidamente colocada em solução fixadora Bouin (ácido

pícrico saturado, formol (35%) e ácido acético na proporção de 15:5:1, respectivamente) por 4

horas em temperatura ambiente ou a 4°C overnight. A remoção do fixador foi realizada em 3

lavagens de 30 minutos cada em tampão fosfato com salina (PBS, 100 mM, 0,9% NaCl, pH

7,4) ou até que o ácido pícrico em excesso fosse retirado. A desidratação era realizada em

bateria crescente de etanol: 50%, 70%, 80%, 90%, 95%, 100%. Cada passo durou 10 minutos

e o último passo foi repetido duas vezes.

Para a diafanização, as cabeças foram colocadas em solução 1:1 de benzol e etanol por

15 minutos, seguido de benzol absoluto três vezes de 15 minutos cada. Logo em seguida o

material foi colocado em parafina derretida (62°) e após 1 hora foi transferido para nova

solução de parafina derretida pelo mesmo período. Após o material ter passado por vácuo em

parafina derretida por 30 minutos, os blocos foram montados em forma laminada. Cortes

seriais de 8µm foram montadas em lâminas pré-tratadas com poli-lisina (20% diluída em água

destilada, imersão de 10 minutos e secagem a 60°C).

Para desparafinização, as lâminas com os cortes foram colocadas em estufa a 80°C por

20 minutos, seguidos de três banhos sucessivos de xilol de 5 minutos cada e série decrescente

de etanol 100%, 90%, 80%, 70%, 50% com 5 minutos cada. Os cortes foram mantidos em

banho com água corrente por 10 minutos e a coloração foi realizada com hematoxilina e

eosina por 2 minutos cada intercalado com um banho de água destilada. Os cortes foram

rapidamente desidratados em etanol 90%, 95% e duas vezes em etanol 100% e levados para

solução xilol/etanol 1:1 (5 minutos de duração em cada passo) seguidos por três banhos de

xilol e finalmente montagem da lamínula com Entellan (Merck).

As lâminas foram analisadas em microscópio invertido Axiovert 35 (Zeiss) e as fotos

obtidas em microscópio Olympus BX50 com câmera Nikon DX1200. O programa utilizado

foi ACT-1 (Nikon V 2.63).

Extração de RNA do lóbulo óptico e cérebro

Para a extração de RNA seguiu-se o protocolo de TRIzol (Invitrogen) para pequenas

quantidades. Diferentes quantidades de lóbulos ópticos foram usadas dependendo da fase de

desenvolvimento segundo tabela 3. Para cada fase do desenvolvimento foram realizadas

extrações em triplicatas para maior representatividade dos dados. Os lóbulos ópticos

Material e Métodos | 23

dissecados em salina Ringer gelado foram rapidamente colocados em tubos Eppendorf (1,5

mL) contendo 500 µL de TRIzol e estocados em freezer -70°C.

As amostras estocadas a -70°C foram deixadas à temperatura ambiente por 5 minutos

e homogeneizadas por aspiração repetida em seringas estéreis. Em seguida adicionou-se 200

µL de clorofórmio e os tubos foram vigorosamente agitados por 15 segundos e novamente

deixados por 3 minutos à temperatura ambiente. As amostras foram centrifugadas a 12.000 g

por 15 minutos a 4°C e a fase superior foi transferida para novo tubo contendo 400 µL de

isopropanol com 5 µg de glicogênio. Após 15 minutos de incubação a temperatura ambiente

as amostras foram centrifugadas (12.000 g, 4°C), o sobrenadante foi removido e ao pellet foi

adicionado 800 µL etanol 75% (em água deionizada tratada com dietilpirocarbonato (DEPC)

0,1%) para lavagem. As amostras foram novamente centrifugadas a 7.500 g por 5 minutos a

4°C e após remoção do sobrenadante o pellet de RNA foi secado em banho seco a 55°C por 5

minutos e, em seguida, dissolvido em 20 µL de água livre de RNase.

Para eliminar possível contaminação com DNA as amostras foram tratadas com

DNase livre de RNAse (Promega) por 40 minutos a 37°C. A inativação da DNase se deu por

incubação a 70°C por 15 minutos.

A quantificação do RNA total foi realizada em espectrofotômetro (NanoVue ND –

1000, GE Healthcare) após diluição apropriada das amostras em água e a leitura foi realizada

a 260 e 280 nm.

Tabela 3. Quantidade de pares de lóbulos ópticos (L.O.) usados para exgração de RNA, por amostra nas respectivas fases de desenvolvimento.

Fase

# de L.O.

Fase

# de L.O.

L3 30

LS3 16

L4 30

PP1 15

LF1 23

PP2 15

LF2 20

PP3 15

LF3

20

Pupa Olho Branca (Pw)

4

Pupa Olho Marrom

LS1 18

4

(Pb)

LS2 16

Síntese da primeira fita de cDNA

A síntese da primeira fita de cDNA foi realizada utilizando transcriptase reversa

ImProm-II (Promega). A partir de uma quantidade inicial de 2 a 3 µg de RNA adicionou-se

oligo(dT)12-18(Invitrogen) como inicializador da reação a qual seguiu as instruções da

Promega. O volume final da reação foi 20 µL e seguiu as condições descritas na Tabela 4.

Material e Métodos | 24

Tabela 4. Reação de síntese da primeira fita de cDNA

Anelamento 25°C

5

minutos

Extensão 42°C

65

minutos

Inativação 70°C

15

minutos

Conservação 4°C

Métodos computacionais

Sistema operacional, linguagens de programação e programas

O trabalho foi desenvolvido em um Macbook Intel core two-duo 2,4 GHz, 3Mb L3

cache, 4 Giga memória RAM, sistema operacional Mac OS X 10.6.8 distribuição Snow Leo-

pard, Kernel Unix (Darwin) versão 10.8.0.

Python é uma linguagem de programação extraordinariamente poderosa, dinâmica e

interpretada (não necessita de compilação) usada em uma grande variedade de aplicações.

Sua codificação é simples, de alto nível com grande capacidade de introspecção, intuitiva e

orientada a objeto. Possui alta compatibilidade e intercambialidade com outras linguagens

como Java (Jython), C e C++ entre outras e especialmente apta para trabalhar com longas

strings. Todas estas características a tornam especialmente útil para desenvolvimento de algo-

ritmos em Bioinformática. No presente trabalho diversos scripts foram escritos em Python

versão 2.7 (vide anexos).

Tabela 5. Principais programas utilizados localmente.

Programa Utilidade

Site

Referência

BLAST Alinhamento

Local

www.ncbi.nlm.nih.gov/BLAST (Altschul et al.,

1990)

CLUS-

Alinhamento Multiplo

www.genome.jp/tools/clustalw/

(Thompson et

TALW

al., 1994)

T-COFFEE Alinhamento

Multiplo www.tcoffee.org/Projects_home_page/ (Notredame et

t_coffee_home_page.html

al., 2000)

PHYLIP Inferência

Filogenética

evolu-

(Felsenstein,

tion.genetics.washington.edu/phylip.ht

1989)

ml

MEME

Localiza motivos con-

meme.nbcr.net

(Bailey; Elkan,

servados por método

1994)

estatístico

Artemis Ferramenta

de

visualiza-

www.sanger.ac.uk

(Rutherford et

ção e anotação de se-

al., 2000)

quencias

R

Análise estatística e ge-

cran.r-project.org/

cran.r-

ração de gráficos

project.org/

Material e Métodos | 25

Base de dados de sequencias gênicas

Os dados utilizados no presente projeto foram baixados localmente a partir de diversas

localidades dispostos na Tabela 6.

Tabela 6. Principais bases de dados utilizadas.

Base de Dados

Site

Referência

GenBank www.ncbi.nlm.nih.gov

ver

site

BEEBASE hymenopteragenome.org/beebase

(Munoz-Torres

et al., 2011)

FlyBase

flybase.org/

(FlyBase Consortium, 2003)

Pfam pfam.janelia.org/ (Sonnhammer

et al., 1998)

Gene Ontology

www.geneontology.org/

(Ashburner et al., 2000)

As regiões promotoras dos genes preditos de Apis mellifera foram obtidas através do site

http://rsat.ulb.ac.be/rsat/ utilizando-se a ferramenta “retrieve sequence”. A região considerada foi

de 1.000 bases a montante do start códon de cada gene sem considerar o start códon. Foi verifica-

da cada região promotora para impedir sobreposição com genes e, neste caso, a região foi reduzi-

da garantindo apenas sequencias não codificadoras, supostamente regulatórias. O banco de dados

utilizado foi o GenBank (Tabela 6). Cada região promotora foi estruturada em um dicionário onde

a chave recebe o ID gênico e, associado à cada chave, está a sequencia correspondente. O dicioná-

rio compreende as regiões promotoras de todos os genes mapeados.

Construção da tabela de proteínas associadas ao termo Gene Ontology “Eye Development”

O Gene Ontology define o termo “Processo Biológico” como sendo uma série de

eventos realizado por um ou mais conjuntos ordenados de funções moleculares em mais de

um passo. Através do banco de dados do FlyBase foi obtido as inferências (“is_a”) ao termo

do Gene Ontology “Eye Development” correspondente aos genes de Drosophila melanogas-

ter. A partir da lista de genes obteve-se todas as proteínas associadas aos genes (isoformas)

montando-se um arquivo separado. Para localizar ortólogos putativos no genoma de Apis foi

realizado o alinhamento local recíproco de proteína (blastp) a partir do arquivo de proteínas

obtidas de Drosophila melanogaster utilizando-se o script “get_reciprocal.py” (ver anexo) (E-

value <= 1e-10). Com isto foi possível montar arquivo contendo as sequencias proteicas de

Apis mellifera que podem ter participação no desenvolvimento do olho.

Busca da região promotora de genes associados ao termo“Eye Development” GO

As sequencias promotoras de genes de Apis mellifera obtidas foram baseadas no for-

mato do GenBank, sendo organizadas pelas coordenadas da região relacionadas com o gene

em questão. Para associar cada região promotora com o respectivo gene foi criado um arquivo

Material e Métodos | 26

de conversão de IDs contendo GenBank ID e GB associado baseado no arquivo de anotação

da ferramenta “MapView” do NCBI considerando a versão 4.0 do genoma (ftp://ftp.ncbi.

nlm.nih.gov//genomes//Apis_mellifera/-mapview/seq_gene.q.gz). O parsing do arquivo

seq_gene.q foi realizado utilizando-se um script em Python.

Em posse do arquivo de conversão de IDs, o dicionário com as sequencias promotoras

e o arquivo com proteínas relacionadas a “Eye Development” de Apis foi possível recuperar

as sequencias promotoras apenas dos genes relacionados com o termo “Eye Development”.

Análise in sílico dos genes candidatos

Para definição estrutural dos genes está sendo utilizada a seqüência codificadora

completa das proteínas de Apis mellifera. Para análise do ortólogo em Apis mellifera utilizou-se a versão 4.0 do genoma da abelha (The Honey Bee Genome Consortium , 2006), as

ferramentas de FlyBase (http://flybase.bio.indiana.edu/) e algoritmos BLAST ( Basic Local

Alignment Search Tool, Altschul et al., 1990) para anotação dos genes, proteínas e seqüências amplificadas. Para análise in sílico dos ortólogos em Apis mellifera e dos primers está sendo utilizado o programa Artemis v11 (www.sanger.ac.uk) (Rutherford et al, 2000)

Anotação dos genes candidatos e desenho de primers

A seqüência das proteínas Roughest, Mini Brain, Eye absent, Small Optic Lobes e

Sine oculis de Drosophila foram utilizadas para identificar seqüências similares (GB 11991-

PA, GB20129-PA, GB11435-PA, GB14881-PA e GB15213-PA respectivamente) presente no

banco de dados de Apis mellifera versão 4.0 (http://www.hgsc.bcm.tmc.edu/projects/

honeybee/) utilizando o algoritmo BLASTP e BLASTN rodando localmente em Mac OS X

versão 10.6.8. As seqüências codificadoras (CDS) foram extraídas dos bancos e analisadas

por BLASTN (versão 2.2.26) contra o banco de dados não-redundante do NCBI

(http://ncbi.nlm.nih.gov/BLAST) para identificação de “mutual best hits” e localização de

possíveis domínios conservados.

A sequência nucleotídica dos respectivos ortólogos foi utilizada para detecção dos

ORFs e montagem dos exons no programa Artemis v.11 (Rutherford et al, 2000). Na anota-

ção as sequências de aminoácidos foram alinhadas com a da proteína predita, considerando a

sequência consenso GT-AG para splicing de finalização e inicialização de exon (Breathnach e

Chambon, 1981). Ao final, as sequências dos exons obtidas foram utilizadas para desenhar

primers específicos.

Material e Métodos | 27

Os primers foram desenhados utilizando-se os programas Primer3 (http://frodo.

wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) e Primer-BLAST (www.ncbi.nlm.nih.gov/

tools/primer-blast/). Foram desenhados primers (Tabela 7) para amplificação de exon inteiro e

primers que anelavam a parte jusante de um exon com a parte montante do exon seguinte para

controlar e detectar possível contaminação das amostras cDNA com DNA genômico.

Tabela 7. Primers específicos para o gene roughest, smal optic lobes (SOL), eye absent (EYA), sine oculis (SO) e minibrain (MNB).

Primer

Seqüência 5´ - 3´

T.m.

F - 5´- ACGAGGATTCGGAGCGACAGG - 3´

62°C

roughest

R - 5´- GGTGCCCGGATGTAGATGTTC G - 3´

62°C

F - 5´- AGCACCAGAAGTGGGAAGATT- 3´

61°C

SOL

R - 5´- TACGTTCTTGCCATCCACAG- 3´

61°C

F - 5´- CCAAAGCGGAAGTGGAAATA – 3’

60°C

EYA

R - 5´- ATGCTACTTGGGCCAGAAGA – 3’

60°C

SO

F – 5’ GACATCGGGCATGTATCAACT – 3’

60ºC

R – 5’ GTTGCAACTGGTGATGAAGGT – 3’

60ºC

F – 5 TAGGGAATCGACGTGTCGTAA – 3’

60ºC

MNB

R – 5’CTGCTGAATCATTGGTGAGGT – 3’

60ºC

F – 5‘ TAATACGACTCACTATAGGGCGAGTGGTATCCTCGTTG-

60ºC

CCACAG

Met-RNAi-T7

R – 5’

60ºC

TAATACGACTCACTATAGGGCGATCCGCAAGCCTGAGTATTCC

F – 5’ AGGCGGGAGCATACACAGTAC

60ºC

Met-RT

R – 5’ TTTTCGTGAGTGGCTGCTTC

60ºC

Normalização dos perfis de cDNA

Os perfis de cDNA de fita simples foram normalizados pelos genes de expressão

quase constitutiva, tais como uma actina citoplasmática (número de acesso no

Official_Gene_Set GB17861) e da proteína ribossomal RP49 (número de acesso GenBank AF

441189). Para actina os primers utilizados são: ACT-Forward 5´- TGC CAA CAC TGT CCT

TTC TG - 3é ACT-Reverse 5´- AGA ATT GAC CCA CCA ATC CA - 3´. Para RP49 os

primers utilizados foram: RP49 - Forward - 5ĆGT CAT ATG TTG CCA ACT GGT - 3é

RP49 Reverse 5´ - TTG AGC ACG TTC AAC AAT GG - 3´. Ambos genes foram utilizados

como normalizadores de PCR quantitativo e semiquantitativo, e a temperatura de anelamento

foi de 60°C.

Material e Métodos | 28

Reação em cadeia da polimerase (PCR semi-quantitativo)

Para amplificação de fragmentos do gene roughest foram preparadas reações de PCR a

partir dos perfís de cDNA gerados para cada fase de desenvolvimento da abelha. Inicialmente

montou-se em um tubo Eppendorf um “master mix” conforme descrito:

Tabela 8: Master mix para reação em cadeia da polimerase.

Água deionizada autoclavada

18,8 µL

Solução tampão para Taq polimerase

2,5 µL

Primer Reverse (0,4 pmol final)

1µL

Primer Forward (0,4 pmol final)

1 µL

Taq Polimerase - Fermentas (5 U/µL)

0,2 µL

cDNA 0,5

µL

dNTP (0,4 µmM final)

1 µL

As amplificações foram realizados em termociclador PTC-200 (MJ Research) nas se-

guintes condições:

a) 95ºC – 5 minutos

b) 95°C – 1 minuto

c) 57°C a 62°C – 30 segundos (dependendo da temperatura de anelamento de cada pri-

mer)

d) 72°C – 30 segundos

e) Repetição dos passos b, c e d (29 vezes para os genes roughest, actina e rp49) f) 72°C – 10 minutos

Após a amplificação, as amostras foram aplicadas em gel de agarose 1% preparados

com tampão TBE (Tris 89 mM, ácido bórico 89 mM, EDTA 2 mM, pH 8,0) e posteriormente

corados em brometo de etídio (0,2 µg/mL).

PCR quantitativa (Real Time – PCR)

Para amplificação dos genes candidatos estão sendo utilizados perfís de cDNA de cada

fase do desenvolvimento da abelha detalhado na tabela 4 e 5. Dois genes controles endógenos

foram utilizados o rp49 e actina para normalização dos dados nos teste com o gene roughest, e o rp49 para os demais. A eficiência dos primers dos genes de controle, actina, rp49, e dos genes candidatos foi verificada em reação quantitativa de PCR utilizando-se diluição de 1:10

até 1:1000 (pelo menos 5 pontos foram considerados) do cDNA e construção de curvas de

Material e Métodos | 29

regressão linear específicas para cada par de primers. Com o valor de Slope, obtifoo pela

curva, calculou-se a eficiência dos primers pela fórmula: E=10(-1/slope). Os valores obtidos para

actina foram de -3,55 de Slope, e correspondente E = 1,91; para o rp49 foram de -3,36 para Slope e E = 1,98, e finalmente para o primer roughest obteve-se -3,63 para Slope e E = 1,88.

Para as análises por PCR quantitativa foi utilizado o protocolo do reagente SYBR®

Green (Applied Biosystems) para o gene roughest e para os demais foi utilizado Maxima SYBR Green/ROX qPCR Master Mix (Fermentas). O volume da reação final foi de 14 µL,

contendo 7 µL do “Master mix” SYBR Green, 1 µL de cada primer (Forward e Reverse a 10

pmol), 4 µL de H2O deionizada e autoclavada e 1 µL de cDNA diluído 1:10. Para cada fase

do desenvolvimento foram preparados três perfis de cDNA e de cada perfil foram montadas

reações em triplicata para o gene alvo e para os genes controles. As reações foram realizadas

em aparelho 7500 Real Time PCR System (Applied Biosystems). A curva de dissociação foi

analisada em cada reação e os valores relativos de expressão dos genes foram calculados

conforme o procedimento CT comparativo (Pfaffl, 2001).

Extração e preparo de RNA para micro-arranjos

Definimos a fase de Spinning II para análise com micro-arranjos. Para cada grupo foi

feita uma duplicata para maior representatividade biológica (SII A e B) tanto em machos

como em fêmeas.

Os lóbulos ópticos dissecados em salina Ringer (autoclavado e filtrado em filtro 0,22µm)

gelado foram rapidamente colocados em tubos Eppendorf (1,5 mL) contendo 500 µL de TRIzol.

As amostras foram imediatamente homogeneizadas utilizando-se pistilos autoclavados. Em

seguida adicionou-se 200 µL de clorofórmio e os tubos foram vigorosamente agitados por 15

segundos e novamente deixados por 10 minutos à temperatura ambiente. As amostras foram

centrifugadas a 12.000 g por 15 minutos a 4°C e a fase superior foi transferida para novo tubo

contendo 400 µL de isopropanol. As amostras em isopropanol foram mantidas em freezer -20ºC

por 24 horas e em seguida centrifugadas (12.000 g, 4°C) por 30 minutos. O sobrenadante foi

removido e ao pellet foi adicionado 800 µL etanol 75% (em água deionizada tratada com

dietilpirocarbonato (DEPC) 0,1%) para lavagem. As amostras foram novamente centrifugadas a

7.500 g por 15 minutos a 4°C e após remoção do sobrenadante o pellet de RNA foi secado em

sistema Speedvac por 3 minutos e, em seguida, dissolvido em 20 µL de água livre de RNase.

Afim de garantir maior pureza das amostras os grupos de RNA foram purificados com o kit

RNeasy MiniKit (Qiagen) antes de proceder com a síntese de aRNA. A quantificação do RNA total

foi realizada em espectrofotômetro (NanoVue ND – 1000) e a leitura foi realizada a 260 e 280 nm.

Material e Métodos | 30

Síntese de aRNA (Amino Allyl RNA)

Para a reação de marcação de RNA com amino allyl (aRNA) utilizamos o Amino

Allyl MessageAmp II aRNA Amplification Kit(Ambion) e os procedimentos foram realizados

de acordo com instruções do fabricante, com modificações para cada amostra. Após

purificação 2 µg de RNA total foi utilizado para iniciar a reação de transcrição reversa para

sintetizar a primeira fita de cDNA através de inicializador oligo(dT) em reação final de 12 µL

em tubo de 0,5 mL. A mistura foi agitada em vórtex, centrifugada 1 minuto a 10.000 rpm e

incubada 10 minutos a 70ºC em termociclador. Em seguida foi adicionado o master mix

(Tabela 9), centrifugado 1 minuto a 10.000 rpm e misturado com pipeta 3 vezes. Cada

amostra foi colocada a 42ºC por 2 horas em banho-maria pré-aquecido. Após incubação as

amostras foram centrifugadas 15 segundos a 10.000 rpm e colocadas em gelo até que o master

mix para síntese da segunda fita de cDNA estivesse pronto.

Tabela 9: Master Mix para reação de transcrição reversa

2 µL

10X First Strand Buffer

4 µL dNTP

mix

1 µL RNase

inhibitor

1 µL ArrayScript

Ao tubo foram adicionados os componentes descritos na tabela 10, de acordo com a

ordem da tabela, brevemente centrifugados, homogeneizados por pipetagem 3 vezes, e

brevemente centrifugados. Cada tubo foi incubado em termo-ciclador a 16ºC por 2 horas

coberto com isopor para evitar grande diferença de temperatura com a do laboratório. Após

incubação os tubos foram colocados em gelo. Antes de proceder para a purificação de cDNA

manteve-se água livre de nuclease aquecida a 55ºC em bloco térmico.

Tabela 10: Master Mix para síntese da segunda fita de cDNA

63 µL Água

Nuclease-free

10 µL

10X Second Strand Buffer

4 µL dNTP

mix

2 µL DNA

Polymerase

1 µL RNase

H

Material e Métodos | 31

Imediatamente após a incubação foi adicionado 250 µL de cDNA Binding Buffer nas

amostras, homogeneizados por pipetagem, colocados em filtro para cDNA e centrifugados 1

minuto a 10.000 rpm. O filtrado foi descartado e ao filtro foi adicionado 500 µL de Wash

Buffer e novamente centrifugado 1 minuto a 10.000 rpm. O filtrado foi descartado e o tubo

com o filtro foi novamente centrifugado nas mesmas condições. Em novo tubo foi adicionado

no filtro 9 µL de água nuclease-free aquecida a 55ºC, incubado por 2 minutos à temperatura

ambiente e centrifugado 2 minutos a 10.000 rpm. Mais 9 µL de água nuclease-free aquecida a

55ºC foi adicionado ao filtro e novamente centrifugado por 2 minutos a 10.000 rpm. Em

seguida as amostras foram colocadas à temperatura ambiente e adicionados os reagentes para

síntese de aRNA modificado com amino allyl de acordo com a Tabela 11. A amostra em cada

tubo foi gentilmente homogeneizado por pipetagem e brevemente centrifugado. Cada tubo foi

incubado a 37ºC por 16 horas em banho-maria.

Tabela 11: Master Mix para síntese de aRNA modificado com amino allyl

3 µL

aaUTP (50mM)

12 µL

ATP, CTP, GTP mix (25mM)

3 µL

Solução de UTP (50mM)

4 µL

T7 10X Reaction Buffer

4 µL

T7 Enzyme Mix

Após a incubação a reação foi parada com 60 µL de água nuclease-free, fazendo com

que o volume chegasse a 100 µL para a purificação. Em cada tubo adicionamos 350 µL de

aRNA Binding Buffer e imediatamente colocamos todo o volume em coluna de filtragem para

aRNA, em novo tubo de 2 mL. À coluna de filtragm foi adicionado 250µL de etanol 100%

(Merck), homogeneizado por pipetagem, centrifugado por 1 minuto a 10.000 rpm. O filtrado

foi descartado e adicionado à coluna 650 µL de Wash Buffer, centrifugado 1 minuto a 10.000

rpm. Após descartar o filtrado o tubo com a coluna foi novamente filtrado para remover

qualquer traço de tampão. A coluna foi transferida para novo tubo e adicionado 100 µL de

água nuclease-free aquecida a 55ºC e deixada a temperatura ambiente por 2 minutos seguido

de centrifugação por 2 minutos a 10.000 rpm.

Com o aRNA purificado e colocado em gelo seguimos com o preparo das cianinas

(Cy3 e Cy5)(GE Healthcare- Amersham Cy Dye Post-Labelling ReactiveDyePack). Para isso

adicionou-se 11 µL de DMSO a cada cianina, homogeneizou-se em vortex e incubou-se por 1

Material e Métodos | 32

hora no escuro em temperatura ambiente. 10 µg do aRNA de cada grupo foi secado em

Speed-vac, adicionado 9µL de Coupling Buffer e gentilmente ressuspendido em vortex. Ao

ressuspendido foi adicionado 11 µL do preparado Dye/DMSO e incubado por 30 minutos no

escuro a temperatura ambiente para permitir a reação de ligamento com as cianinas. Para

parar a reação foi adicionado 4,5µL de hydroxilamina 4 M, gentilmente misturado com vortex

e incubado no escuro por mais 15 minutos a temperatura ambiente. À cada tubo foi

adicionado 5,5 µL de água nuclease-free e prosseguimos com a purificação. Adicionamos 105

µL de aRNA Binding Buffer em cada amostra seguido de 75 µL de etanol 100% (Merck) e

homogeneizamos por pipetagem. Imediatamente as amostras foram colocadas em coluna de

filtragem de aRNA e centrifugado por 1 minuto a 10.000 rpm. 500 µL de Wash Buffer foi

utilizado para a limpeza de cada amostra na coluna e o tubo com a coluna de filtragem foi

novamente centrifugado 2 vezes 1 minuto cada a 10.000 rpm para retirar qualquer resíduo.

Para eluir o aRNA marcado foi aplicado 10 µL de água nuclease-free pré-aquecida no centro

da coluna, deixado à temperatura ambiente por 2 minutos e centrifugado 2 minutos a 10.000

rpm. Este passo foi repetido e o total resgatado foi de aproximadamente 20 µL.

Integridade do RNA para microArray

Para garantir o máximo de integridade de RNA para a preparação do microArray, logo

após a purificação do RNA, prosseguimos imediatamente com a síntese de aRNA com as

amostras que apresentaram razão 260/280 nm entre 1,7 e 1,9 ou maior que 2 medido em

espectrofotômetro NanoVue.

Preparo e hibridação das lâminas de microArray

As lâminas de microarray foram umedecidas em vapor de água, tomando cuidado para

não formar gotículas sob a mesma. Imediatamente as lâminas foram secadas em termo-bloco a

58ºC e levada para UV crosslinker por 6000 X 100µJ/cm2 para fixar o DNA na lâmina. Ao final

do processo prosseguimos com as lavagens das lâminas começando em solução SDS 0,2% por 2

minutos sob forte agitação. Em seguida as lâmina foram lavadas 2 vezes em água milliQ com 15

agitos cada e deixadas em isopropanol por 1 minuto. As lâminas foram centrifugadas a 2000 rpm

por 3 minutos e em seguida foram incubadas por pelo menos 45 minutos a 42ºC em solução de

pré-hibridação (formamida 20 mL, solução de Denhardt’s 100X 5 mL, tampão SSC 20X 33,2

mL, SDS 10% 1mL, tRNA 10 mg/mL 0,5 mL e água milliQ 40,3 mL).

Após a pré-hibridação as lâminas foram lavadas em água milliQ 2 vezes com 15

movimentos de agitação e em seguidas colocadas em isopropanol. As lâmina foram centrifugadas

Material e Métodos | 33

a 2000 rpm por 3 minutos e deixadas em termo-bloco com mapa guia para lamínula em baixo.

Para os experimentos utilizamos as duas cianinas, Cy3 e Cy5, e por isso, misturamos as amostras

específicas determinadas para cada lâmina em tubos 0,5 mL. Aos tubos adicionamos 40µL de

solução de hibridação (formamida deionizada 0,98 mL, tampão SSC 20X 0,98 mL) o qual foi

desnaturado a 99ºC por 3 minutos. Lamínulas específicas foram limpas em ar comprimido e

colocados em cima das lâminas seguindo a ordem do mapa, e o conteúdo do tubo foi pipetado

entre a lamínula e a lâmina e deixado que o liquido tomasse toda a superfície. Imediatamente o

conjunto foi colocado em cassete próprio contendo 40 µL de solução de hibridação, enrolado em

papel alumínio e incubado em banho-maria a 42ºC submerso por 16 horas. Após a incubação o

cassete foi desmontado e cada lâmina foi colocada em solução pós-hibridação 1 (SDS 2% 50 mL,

SSC 20X 100 mL e água milliQ 850 mL) em banho-maria a 42ºC por 2 minutos para desgrudar a

lamínula. Em seguida as lâminas foram trocadas para novo coupling jar contendo solução pós-

hibridação 1 e mexidas vigorosamente 30 vezes e deixado descansar por 2 minutos. O

procedimento foi repetido com a mesma solução; este procedimento é realizado em cada troca de

solução. As lâminas foram transferidas para solução pós-hibridação 2 (SDS 2% 5 mL, SSC 20X

25 mL, água milliQ 970 mL) e o procedimento repetido com a mesma solução. Após 2 minutos

de descanso as lâminas foram colocadas em nova solução de pós-hibridação 3 (SSC 20X 100mL,

água milliQ 900mL) e mexidas vigorosamente 30 vezes e deixado descansar por 2 minutos, o

processo é repetido. As lâminas passavam 2 vezes, também, pela solução de pós-hibridação 4

(SSC 20X 5 mL, água milliQ 995 mL) com 30 movimentos de agitação e descanso de 2 minutos.

Os mesmos procedimentos são repetidos 2 vezes, porém agora em coupling jar contendo apenas

água milliQ e as lâminas são levadas para centrifugação por 3 minutos a 2000 rpm. Em seguida as

lâminas foram guardadas em caixa em mantidas no escuro até o momento de escaneá-las.

Análise Estatística de dados do MicroArray.

As análises estatísticas foram desenvolvidas utilizando-se o pacote estatístico R (R

Development Core Team, 2011) versão 2.13.2 para Mac. Para a análise estatística de dados do

microArray utilizamos o pacote Limma (Smyth, 2005) proveniente da biblioteca

Bioconductor (Gentleman, et al. 2004) no R. Para análise de expressão diferencial utilizamos

abordagem empírica de Bayes e modelo linear (Smyth, , 2004). O design do experimento

levou em consideração duplicatas técnicas de spots e de lâminas e, portanto, utilizamos a

abordagem utilizada por Smyth et al, (2005). Para normalização de dados de microarray de

duas cores (Cy3 e Cy5) utilizamos a abordagem de Smyth, e Speed(2003). Utilizamos o

método de correção de fundo descrito em Ritchie et al, (2007) para análise das lâminas.

Resultados | 34

Resultados

Análise do desenvolvimento através de cortes seriais.

A abelha Apis mellifera é um dos mais fascinantes insetos, em grande parte devido à

sua estrutura hierárquica altamente estruturada com divisões de tarefas e dominância pela rai-

nha, seus produtos utilizados pelo homem e sua importância como polinizador na natureza.

Além disso, este inseto apresenta grande plasticidade fenotípica entre os sexos e castas deter-

minado por regulação gênica e eventos epigenômicos diferenciais orquestrados por alimenta-

ção diferencial no caso das castas e por splicing alternativo no gene double-sex em machos.

Uma das estruturas mais notáveis ocasionadas por esse processo são os olhos. Em zangões o

olho possui o dobro do tamanho na fase adulta quando comparado com operárias apesar de

possuir o mesmo genoma.

No presente projeto coletamos zangões através de postura controlada em diferentes es-

tágios de desenvolvimento pós-embrionário. Ainda pouco se sabe sobre o tamanho da capsula

cefálica e tempo de muda nos estágios iniciais pós-embrionários. Para tanto utilizamos postu-

ras controladas em favo contendo células de zangões e coletamos em períodos de 24 horas

para melhor definição do primeiro ao quarto estágios larvais. Com os estágios larvais bem

definidos, coletamos indivíduos de 4 dias de desenvolvimento (terceiro instar larval) os quais

tiveram sua capsula cefálica removida e imediatamente colocada em solução fixadora e em-

bebida em parafina para obtenção de cortes seriais corados com hematoxilina e eosina.

No quarto dia do desenvolvimento (3º instar larval) notamos um centro de diferencia-

ção (seta amarela Figura 3A) adjacente ao cérebro, no local onde será definido o lóbulo ópti-

co. O definimos como centro de diferenciação por ter origem neuroepitelial e não disco ima-

ginal do olho como em Drosophila. Este centro apresenta-se em forma discoide, constituído

essencialmente de corpos de neurónios e está próximo à epiderme. Na epiderma encontra-se

uma região com maior espessamento (seta preta Figura 3-A) próxima ao lóbulo óptico quando

comparado com regiões mais distantes. A epiderme na região com maior espessamento dará

origem à retina no adulto. Nesta fase a capsula cefálica mede em média 630 µm sendo que o

centro de diferenciação é inferior a 100 µm.

Coletas realizadas 24 horas mais tarde (4º instar larval) mostram zangões com um

grande aumento na capsula cefálica, tendo em média 1050 µm de diâmetro. É evidente que o

centro de diferenciação continua mantendo seu formato parecido com no estágio anterior (L3)

(seta amarela Figura 3B). Contudo, apesar da forma parecida, o centro de diferenciação apre-

index-36_1.jpg

index-36_2.jpg

index-36_3.jpg

index-36_4.jpg

index-36_5.jpg

index-36_6.jpg

index-36_7.jpg

index-36_8.jpg

index-36_9.jpg

index-36_10.jpg

index-36_11.jpg

index-36_12.jpg

index-36_13.jpg

index-36_14.jpg

index-36_15.jpg

index-36_16.jpg

index-36_17.jpg

index-36_18.jpg

index-36_19.jpg

index-36_20.jpg

index-36_21.jpg

index-36_22.jpg

Resultados | 35

senta-se com diâmetro maior que 100 µm. A epiderme também mantém o espessamento na

região adjacente ao centro de diferenciação (seta preta Figura 3B) quando comparado com

regiões mais distantes como por exemplo na região evidenciada com uma estrela na Figura

3B.

Figura 3: Desenvolvimento do lóbulo óptico em fases larvais iniciais em zangões visualizado em cortes histoló-

gico corados com hematoxilina e eosina.. A) Terceiro instar larval em zangões. Seta amarela mostra o primórdio do lóbulo óptico. Seta preta mostra a epiderme espessa logo acima, lembrando uma estrutura tipo placóide. B) Quarto ínstar larval em zangões. A seta amarela mostra o começo do desenvolvimento do lóbulo óptico, ainda em fase inicial de diferenciação. Adjacente ao lóbulo óptico o placóide epidermal coontinua mais espessa (seta preta), sendo que dorsalmente, estrela, a epiderme encontra-se mais fina. Barra 100 µm.

Após o quarto instar a larva atiinge a fase de alimentação do quinto, onde há um gran-

de aumento de peso. A fase de alimentação é mais longa e costuma demorar cerca de 36 horas

ao invés de 24 como as anteriores. Desta forma pesamos indivíduos loogo após a ecdise entre

quarto e quinto instar, e indivíduos com as células quase totalmente operculadas. Com isso

pudemos dividir a fase de alimentação em três sub-partes: as primeiras 12 horas após a ecdise,

com animais pesando entre 40 e 129 mg, de 12 a 24 horas, com animaiis pesando entre 130 a

269 mg, e de 24 a 36 horas, com animais pesando mais de 270 mg. Observa-se que zangões

aumentam drasticamente em tamanho, e o crescimento geral é acompanhado pelos lóbulos

ópticos que não apresentam mais o aspecto indiferenciado do centro de diferenciação das fa-

ses anteriores. Agora é possível observar o surgimento de uma estrutura

a que está começando a

cobrir o antigo centro de diferenciação (seta amarela Figura 4A). Do antigo centro de diferen-

ciação surge uma estrutura com aspecto glomerular formado por corpos celulares neuronais,

sendoo que o interior apresenta grande densidade de axônios (seta preta Figura 4A). Tais axô-

nios conectam esta estrutura com uma outra, proximal em relação ao cérebro e também pro-

index-37_1.jpg

index-37_2.jpg

index-37_3.jpg

index-37_4.jpg

index-37_5.jpg

index-37_6.jpg

index-37_7.jpg

index-37_8.jpg

index-37_9.jpg

index-37_10.jpg

index-37_11.jpg

index-37_12.jpg

index-37_13.jpg

index-37_14.jpg

index-37_15.jpg

index-37_16.jpg

index-37_17.jpg

index-37_18.jpg

index-37_19.jpg

index-37_20.jpg

index-37_21.jpg

index-37_22.jpg

index-37_23.jpg

Resultados | 36

veniente do centro de diferenciação. Ainda não é possível notar diferenças significantes na

epiderme até 24 horas da fase de alimentação do quinto instar. Notavelmente, após 24 horas

do início da fase de alimentação o lóbulo óptico mostra diferenciação das estruturas de forma

mais acelerada. A estrutura que cobree o antigo centro de diferenciação se parece mais com a

lamina no olho adulto (seta amarela Figura 4B). Internamente à lamina oo centro de diferencia-

ção apresenta-se semelhante à medula no adulto, com aspecto glomerular composta externa-

mente por grossa camada de corpos celulares neuronais e internamente pelos axônios. Inter-

namente à medula encontra-se outra estrutura, a lóbula (estrela branca Figura 3B), que cerca

de 12 horas antes apresentava-se apenas como pequena massa de neurônios e agora está mais

desenvolvida e densamente conectada com o cérebro pelos axônios. A eepiderme também está

bem mais espessa que 12 horas antes, sendo que o espessamento atinge regiões mais dorsais e

ventrais (estrela preta Figura 4B).

Figura 4: Desenvolvimento do lóbulo ópticoo durante a fase de alimentação do quinto instar larval em zangões.

A) Fase de alimentação II em zangões. Seta amarela mostra o primórdio da lamina cobrindo a medula (seta preta). Estrela mostra o espessamento característico da epiderme adjacente ao primórdio de lóbulo optico. B) Fase de alimentação III em zangões. A seta amarela mostra lamina cobrindo a medula. A medula está bem desenvolvida e é evidenciada pela seta preta. Internamente, uma nova estrutura está evidente (estrela branca), fortemente conectada com o cérebro pelos feixes axonais. Nota-se a epiderme adjacente mais espessa (estrela) atingindo regiões mais dorsais e ventrais. Barra 100 µm.

Após intensa alimentação a larva atinge o peso crítico e não é mais alimentada pelas

abelhas nutridoras. A partir deste ponto a larva entra em metamorfose e mantem suas funções

fisiológicas com a reserva adquirida e estocada no corpo gorduroso. O opérculo da célula é

fechado e a larva começa a tecer seu ccasulo. Durante a fase de tecelagem de casulo a lâmina

continua a se desenvolver, cobrindo internamente a medula (seta Figura 5A). A epiderme

apresenta-se da mesma forma que na fase anterior. Cada estrutura do llóbulo óptico (lâmina,

index-38_1.jpg

index-38_2.jpg

index-38_3.jpg

index-38_4.jpg

index-38_5.jpg

index-38_6.jpg

index-38_7.jpg

index-38_8.jpg

index-38_9.jpg

index-38_10.jpg

index-38_11.jpg

index-38_12.jpg

index-38_13.jpg

index-38_14.jpg

index-38_15.jpg

index-38_16.jpg

index-38_17.jpg

index-38_18.jpg

index-38_19.jpg

index-38_20.jpg

index-38_21.jpg

index-38_22.jpg

index-38_23.jpg

Resultados | 37

medula e lóbula) está com tamanho au

aumentado em relação à fase de allimentação. Na Figura

5B (seta) nota-se o aparecimento de feixes axonais conectando a epiderme adjacente (retina)

com a camada mais externa do lóbulo óptico, a lâmina. Nota-se na epiderme o começo da

formação de estruturas colunares, os quais serão os futuros omatídeos no

no adulto. Internamente

à medula, a lóbula, está bem desenvolvida (elipse Figura 5B) e altamente conectada com o

cérebro.

Figura 5: Desenvolvimento do lóbulo ópticoo durante a fase de tecelagem de casulo (Spinning) em zangões. A) Fase de tecelagem de casulo III em zangões. Seta branca mostra a lamina. B) Fase de ttecelagem de casulo III em zangões. Feixes axonais são visíveis nesta fase (seta). Elipse marca a lóbula bem desenvolvida internamenteà medula. Nota-se a epiderme adjacente espessa atingindo regiões mais dorsais e ventrais. Barra 100µm.

A fase pré-pupal é caracterizada por profundas modificações morfológicas, entre elas

o alargamento dos olhos e a apólise iddentificando o começo da muda larval-pupal. Devido à

formação de nova cutícula e os procedimentos para fixação, as estruturas internas aparecem

deslocados. Contudo, é notável o desenvolvimento da retina mostrado ppela cabeça de seta na

Figura 6A. A lâmina continua a se diferenciar (seta Figura 6A) e é possível observar a cone-

xão axonal entre a mesma e a medula, formando o primeiro quiasma ópttico. Entre a lóbula e a

medula é possível observar o segundo quiasma óptico (elipse Figura 6A). Durante o processo

de diferenciação da retina a parte mais adjacente à lâmina torna-se clusterizada mais rapida-

mente que as regiões dorsal e ventral dda epiderme. Na Figura 6B é possível observar a região

mais diferenciada, evidenciando um omatídeo com seus feixes axonais atingindo a membrana

basal. Detalhes da retina (Figura 6C) na parte dorsal mostram que o proccesso de formação dos

clusteres omatidiais ainda é inicial.

index-39_1.jpg

index-39_2.jpg

index-39_3.jpg

index-39_4.jpg

index-39_5.jpg

index-39_6.jpg

index-39_7.jpg

index-39_8.jpg

index-39_9.jpg

index-39_10.jpg

index-39_11.jpg